Stem-loop sequence hsa-mir-4771-2

AccessionMI0017413 (change log)
Symbol HGNC:MIR4771-2
DescriptionHomo sapiens miR-4771-2 stem-loop
Gene family MIPF0001258; mir-4771
Stem-loop 
          c      u   a  u         -c  u 
5' gcucuag cuaauu uag uc ggucugcuu  ag u
   ||||||| |||||| ||| || |||||||||  || u
3' cgagauc gauuaa auc ag ucagacgaa  uc c
          c      c   c  u         cc  a
Get sequence
Deep sequencing
9 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 111771061-111771134 [-]
antisense
OTTHUMT00000331954 ; ACOXL-012; intron 1
OTTHUMT00000331949 ; ACOXL-007; intron 2
OTTHUMT00000331948 ; ACOXL-006; intron 3
OTTHUMT00000331953 ; ACOXL-011; intron 8
OTTHUMT00000376017 ; ACOXL-013; intron 14
OTTHUMT00000254024 ; ACOXL-001; intron 15
ENST00000496981 ; ACOXL-012; intron 1
ENST00000441974 ; ACOXL-007; intron 2
ENST00000443586 ; ACOXL-006; intron 3
ENST00000417074 ; ACOXL-011; intron 8
ENST00000439055 ; ACOXL-013; intron 14
ENST00000389811 ; ACOXL-001; intron 15
Database links

Mature sequence hsa-miR-4771

Accession MIMAT0019925
Sequence

45 -  

agcagacuugaccuacaauua

 - 65

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).