![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4773-2 |
||||||
Accession | MI0017416 (change log) | |||||
Symbol | HGNC:MIR4773-2 | |||||
Description | Homo sapiens miR-4773-2 stem-loop | |||||
Gene family | MIPF0001250; mir-4773 | |||||
Stem-loop |
u au
5' gcuccccagccuuucuaugcuccuguucugcuuug g
|||||||||||||||||||||||||||||||||||
3' cgaggggucggaaagauacgaggacaagacgaaau a
a aa
|
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence hsa-miR-4773 |
|
Accession | MIMAT0019928 |
Sequence |
48 - cagaacaggagcauagaaaggc - 69 |
Deep sequencing | 41 reads, 12 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|