Stem-loop sequence hsa-mir-4773-2

AccessionMI0017416 (change log)
Symbol HGNC:MIR4773-2
DescriptionHomo sapiens miR-4773-2 stem-loop
Gene family MIPF0001250; mir-4773
Stem-loop
   u                                   au 
5'  gcuccccagccuuucuaugcuccuguucugcuuug  g
    |||||||||||||||||||||||||||||||||||   
3'  cgaggggucggaaagauacgaggacaagacgaaau  a
   a                                   aa 
Get sequence
Deep sequencing
56 reads, 18.9 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 151368334-151368411 [-]
sense
OTTHUMT00000332342 ; RND3-003; intron 1
ENST00000439275 ; RND3-003; intron 1
Clustered miRNAs
< 10kb from hsa-mir-4773-2
hsa-mir-4773-2chr2: 151368334-151368411 [-]
hsa-mir-4773-1chr2: 151368334-151368411 [+]
Database links

Mature sequence hsa-miR-4773

Accession MIMAT0019928
Sequence

48 - 

cagaacaggagcauagaaaggc

 - 69

Get sequence
Deep sequencing41 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).