![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4774 |
|||||
Accession | MI0017417 (change log) | ||||
Symbol | HGNC:MIR4774 | ||||
Description | Homo sapiens miR-4774 stem-loop | ||||
Gene family | MIPF0001578; mir-4774 | ||||
Literature search |
1 open access papers mention hsa-mir-4774 | ||||
Stem-loop |
uaua g ag -aa a 5' uuguu ucugguaugu uagguaau cug c ||||| |||||||||| |||||||| ||| a 3' aacaa agaccgugua auccguua gac a auac a ca aca a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4774-5p |
|
Accession | MIMAT0019929 |
Sequence |
11 - ucugguauguaguagguaauaa - 32 |
Deep sequencing | 57 reads, 26 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
Mature sequence hsa-miR-4774-3p |
|
Accession | MIMAT0019930 |
Sequence |
47 - auugccuaacaugugccagaa - 67 |
Deep sequencing | 11 reads, 4 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
2 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|