![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4777 |
|||||
Accession | MI0017421 (change log) | ||||
Symbol | HGNC:MIR4777 | ||||
Description | Homo sapiens miR-4777 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4777 | ||||
Stem-loop |
u ag a cu 5' uagaauauu cggcauucuagaugag auau uauauac c ||||||||| |||||||||||||||| |||| ||||||| a 3' aucuuauaa gucguaagaucuacuc uaug guauaug u u ca - ua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4777-5p |
|
Accession | MIMAT0019934 |
Sequence |
16 - uucuagaugagagauauauaua - 37 |
Deep sequencing | 14 reads, 5 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4777-3p |
|
Accession | MIMAT0019935 |
Sequence |
57 - auaccucaucuagaaugcugua - 78 |
Deep sequencing | 10 reads, 8 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|