![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4783 |
|||||
Accession | MI0017428 (change log) | ||||
Symbol | HGNC:MIR4783 | ||||
Description | Homo sapiens miR-4783 stem-loop | ||||
Stem-loop |
aa a - u c g cg 5' ggg agcgg gggcgcgccc agc cc gggcu auug c ||| ||||| |||||||||| ||| || ||||| |||| 3' ccc ucgcc ucugcgcggg uug gg cccgg ugac u cg g g u c - aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4783-5p |
|
Accession | MIMAT0019946 |
Sequence |
13 - ggcgcgcccagcucccgggcu - 33 |
Deep sequencing | 9 reads, 6 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4783-3p |
|
Accession | MIMAT0019947 |
Sequence |
51 - ccccgguguuggggcgcgucugc - 73 |
Deep sequencing | 75 reads, 25 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|