![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4784 |
|||||
Accession | MI0017429 (change log) | ||||
Symbol | HGNC:MIR4784 | ||||
Description | Homo sapiens miR-4784 stem-loop | ||||
Stem-loop |
u - g cu gau u u a gu a 5' gac ug g gagga gc gggac gag gu c u ||| || | ||||| || ||||| ||| || | g 3' uug ac c cuccu cg cccug cuc cg g g g u g cu acu u c - ag u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4784 |
|
Accession | MIMAT0019948 |
Sequence |
10 - ugaggagaugcugggacuga - 29 |
Deep sequencing | 48 reads, 23 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|