Stem-loop sequence hsa-mir-4784

Accession

MI0017429 (change log)

Symbol

HGNC:MIR4784

Description

Homo sapiens miR-4784 stem-loop

Stem-loop

   u   -  g cu     gau  u     u   a  gu a 
5'  gac ug g  gagga   gc gggac gag gu  c u
    ||| || |  |||||   || ||||| ||| ||  | g
3'  uug ac c  cuccu   cg cccug cuc cg  g g
   g   u  g cu     acu  u     c   -  ag u 

Deep sequencing

64 reads, 0 reads per million, 31 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 131491160-131491236 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR4784
• HGNC:MIR4784
• miRBase Tracker:MI0017429

Mature sequence hsa-miR-4784

• Accession: MIMAT0019948
• Sequence: 10 - ugaggagaugcugggacuga - 29
• Deep sequencing: 48 reads, 23 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4784
  • TargetScanVert:hsa-miR-4784
  • miRDB:hsa-miR-4784

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).