Stem-loop sequence hsa-mir-4788

Accession

MI0017435 (change log)

Symbol

HGNC:MIR4788

Description

Homo sapiens miR-4788 stem-loop

Gene family

MIPF0001573; mir-4788

Literature search

1 open access papers mention hsa-mir-4788
(1 sentences)

Stem-loop

               c                   uu     c 
5' aaugaaggauua ggaccagcuaagggaggca  aggau c
   |||||||||||| |||||||||||||||||||  |||||  
3' uugcuuccuaau ccugguugauucccuccgu  ucuua u
               c                   --     u 

Deep sequencing

33 reads, 4.35 reads per million, 23 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr3: 134437827-134437906 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000357425 ; EPHB1-004; intron 1

  OTTHUMT00000357424 ; EPHB1-003; intron 2

  ENST00000460895 ; EPHB1-004; intron 1

  ENST00000467708 ; EPHB1-003; intron 2

Database links

• EntrezGene:MIR4788
• HGNC:MIR4788
• miRBase Tracker:MI0017435

Mature sequence hsa-miR-4788

• Accession: MIMAT0019958
• Sequence: 10 - uuacggaccagcuaagggaggc - 31
• Deep sequencing: 31 reads, 23 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4788
  • TargetScanVert:hsa-miR-4788
  • miRDB:hsa-miR-4788

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).