Stem-loop sequence hsa-mir-4796

Accession

MI0017443 (change log)

Symbol

HGNC:MIR4796

Description

Homo sapiens miR-4796 stem-loop

Gene family

MIPF0001402; mir-4796

Stem-loop

                                  --uu    c 
5' uaaauuugugucuauacucugucacuuuacu    uggc u
   |||||||||||||||||||||||||||||||    |||| c
3' auuuaaacacagauaugagacggugaaauga    acug a
                                  cguu    a 

Deep sequencing

212 reads, 0 reads per million, 83 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr3: 114743445-114743525 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000354954 ; ZBTB20-006; intron 1

  OTTHUMT00000354953 ; ZBTB20-005; intron 1

  OTTHUMT00000354961 ; ZBTB20-013; intron 1

  OTTHUMT00000354956 ; ZBTB20-008; intron 1

  OTTHUMT00000354958 ; ZBTB20-010; intron 1

  OTTHUMT00000354960 ; ZBTB20-012; intron 2

  ENST00000462705 ; ZBTB20-006; intron 1

  ENST00000357258 ; ZBTB20-005; intron 1

  ENST00000463890 ; ZBTB20-013; intron 1

  ENST00000492665 ; ZBTB20-008; intron 1

  ENST00000488663 ; ZBTB20-010; intron 1

  ENST00000470186 ; ZBTB20-012; intron 2

Database links

• EntrezGene:MIR4796
• HGNC:MIR4796
• RNAcentral:URS000075A67E_9606
• miRBase Tracker:MI0017443

Mature sequence hsa-miR-4796-5p

• Accession: MIMAT0019970
• Sequence: 9 - ugucuauacucugucacuuuac - 30
• Deep sequencing: 70 reads, 47 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4796-5p
  • TargetScanVert:hsa-miR-4796-5p
  • miRDB:hsa-miR-4796-5p

Mature sequence hsa-miR-4796-3p

• Accession: MIMAT0019971
• Sequence: 53 - uaaaguggcagaguauagacac - 74
• Deep sequencing: 137 reads, 63 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS000025EABA_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4796-3p
  • TargetScanVert:hsa-miR-4796-3p
  • miRDB:hsa-miR-4796-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).