Stem-loop sequence hsa-mir-4799

Accession

MI0017446 (change log)

Symbol

HGNC:MIR4799

Description

Homo sapiens miR-4799 stem-loop

Stem-loop

              c                     gag 
5' acugcuaauau uaaaugcagcaugccaguccu   a
   ||||||||||| |||||||||||||||||||||    
3' ugacgauuaua auuuacgucguacggucaggg   u
              u                     acg 

Deep sequencing

58 reads, 0 reads per million, 34 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr4: 147782595-147782668 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000367025 ; TTC29-003; intron 8

  OTTHUMT00000367024 ; TTC29-002; intron 8

  OTTHUMT00000367023 ; TTC29-001; intron 9

  ENST00000398886 ; TTC29-202; intron 7

  ENST00000508306 ; TTC29-003; intron 8

  ENST00000504425 ; TTC29-002; intron 8

  ENST00000325106 ; TTC29-201; intron 8

  ENST00000513335 ; TTC29-001; intron 9

Database links

• EntrezGene:MIR4799
• HGNC:MIR4799
• miRBase Tracker:MI0017446

Mature sequence hsa-miR-4799-5p

• Accession: MIMAT0019976
• Sequence: 10 - aucuaaaugcagcaugccaguc - 31
• Deep sequencing: 50 reads, 32 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4799-5p
  • TargetScanVert:hsa-miR-4799-5p
  • miRDB:hsa-miR-4799-5p

Mature sequence hsa-miR-4799-3p

• Accession: MIMAT0019977
• Sequence: 45 - acuggcaugcugcauuuauaua - 66
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4799-3p
  • TargetScanVert:hsa-miR-4799-3p
  • miRDB:hsa-miR-4799-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).