Stem-loop sequence hsa-mir-4800

Accession

MI0017448 (change log)

Symbol

HGNC:MIR4800

Description

Homo sapiens miR-4800 stem-loop

Stem-loop

      --  a   --a      c  -   a   a   -     a 
5' gga  ga agg   guggac ga gga gga gga aggca g
   |||  || |||   |||||| || ||| ||| ||| |||||  
3' ccu  cu ucc   caccug cu ccu ccu ccu ucugu g
      ga  g   auc      u  g   g   a   g     c 

Deep sequencing

339 reads, 4.26 reads per million, 94 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr4: 2250077-2250156 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000206519 ; MXD4-001; 3'UTR (exon 6)

  ENST00000337190 ; MXD4-001; 3'UTR (exon 6)

Database links

• EntrezGene:MIR4800
• HGNC:MIR4800
• RNAcentral:URS000075B063_9606
• miRBase Tracker:MI0017448

Mature sequence hsa-miR-4800-5p

• Accession: MIMAT0019978
• Sequence: 10 - aguggaccgaggaaggaagga - 30
• Deep sequencing: 130 reads, 47 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS0000539562_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4800-5p
  • TargetScanVert:hsa-miR-4800-5p
  • miRDB:hsa-miR-4800-5p

Mature sequence hsa-miR-4800-3p

• Accession: MIMAT0019979
• Sequence: 48 - cauccguccgucuguccac - 66
• Deep sequencing: 189 reads, 65 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4800-3p
  • TargetScanVert:hsa-miR-4800-3p
  • miRDB:hsa-miR-4800-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).