![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4800 |
|||||
Accession | MI0017448 (change log) | ||||
Symbol | HGNC:MIR4800 | ||||
Description | Homo sapiens miR-4800 stem-loop | ||||
Stem-loop |
-- a --a c - a a - a 5' gga ga agg guggac ga gga gga gga aggca g ||| || ||| |||||| || ||| ||| ||| ||||| 3' ccu cu ucc caccug cu ccu ccu ccu ucugu g ga g auc u g g a g c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4800-5p |
|
Accession | MIMAT0019978 |
Sequence |
10 - aguggaccgaggaaggaagga - 30 |
Deep sequencing | 130 reads, 47 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-4800-3p |
|
Accession | MIMAT0019979 |
Sequence |
48 - cauccguccgucuguccac - 66 |
Deep sequencing | 189 reads, 65 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|