Stem-loop sequence hsa-mir-4803

AccessionMI0017451 (change log)
Symbol HGNC:MIR4803
DescriptionHomo sapiens miR-4803 stem-loop
Gene family MIPF0001511; mir-4803
Stem-loop 
                  a         a     ucaca 
5' agugggauuuaacau auagugugg uugaa     c
   ||||||||||||||| ||||||||| |||||      
3' uuacccuaaauugua uaucacacc aacuu     a
                  g         c     uacac
Get sequence
Deep sequencing
39 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 72169467-72169540 [+]
sense
OTTHUMT00000368909 ; TNPO1-004; intron 1
OTTHUMT00000368908 ; TNPO1-003; intron 2
OTTHUMT00000374941 ; TNPO1-011; intron 5
OTTHUMT00000377859 ; TNPO1-013; intron 6
OTTHUMT00000218577 ; TNPO1-001; intron 7
OTTHUMT00000368911 ; TNPO1-006; intron 7
ENST00000505082 ; TNPO1-004; intron 1
ENST00000508762 ; TNPO1-003; intron 2
ENST00000520850 ; TNPO1-011; intron 5
ENST00000447967 ; TNPO1-201; intron 5
ENST00000523768 ; TNPO1-013; intron 6
ENST00000454282 ; TNPO1-202; intron 6
ENST00000337273 ; TNPO1-001; intron 7
ENST00000506351 ; TNPO1-006; intron 7
Database links

Mature sequence hsa-miR-4803

Accession MIMAT0019983
Sequence

10 -  

uaacauaauaguguggauuga

 - 30

Get sequence
Deep sequencing35 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).