Stem-loop sequence tcc-MIR395a

Accession

MI0017509

Description

Theobroma cacao miR395a stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

agaga     c    cu u          ug c       c   ---       cuggac   u 
     gucag uguc  c ggaguucccc  a cacuuca uag   agguuuc      ccu a
     ||||| ||||  | ||||||||||  | ||||||| |||   |||||||      |||  
     caguc acgg  g ccucaagggg  u gugaagu auc   uccaaag      gga a
uguaa     c    uu u          gu u       c   cag       ----aa   u 

Mature sequence tcc-miR395a

• Accession: MIMAT0020425
• Sequence: 83 - cugaaguguuugggggaacuc - 103
• Evidence: not experimental

References

1. PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).