Stem-loop sequence dme-mir-4919

AccessionMI0017702 (change log)
DescriptionDrosophila melanogaster miR-4919 stem-loop
Literature search

1 open access papers mention dme-mir-4919
(2 sentences)

Stem-loop
   -- ug    ucua         caagcuau 
5'   g  aguc    ggggauuag        a
     |  ||||    |||||||||         
3'   c  ucag    ucccuaauu        a
   ga gu    caag         cacucuuu 
Get sequence
Deep sequencing
1548 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 15945887-15945946 [+]
sense
FBtr0114558 ; Cyp4aa1-RB; intron 3
Database links

Mature sequence dme-miR-4919-5p

Accession MIMAT0020513
Sequence

1 - 

gugagucucuaggggauuagc

 - 21

Get sequence
Deep sequencing24 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4919-3p

Accession MIMAT0032117
Sequence

40 - 

uaaucccugaacgacuugcag

 - 60

Get sequence
Deep sequencing1522 reads, 37 experiments
Evidence not experimental
Database links

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).