Stem-loop sequence cel-mir-4930

AccessionMI0017716 (change log)
DescriptionCaenorhabditis elegans miR-4930 stem-loop
Stem-loop
   --        aggg   ug   --a    u    aggg   ug   --a    u   uag 
5'   gucugccu    ggc  gcu   gggc gccu    ggc  gcu   gggc gcc   g
     ||||||||    |||  |||   |||| ||||    |||  |||   |||| |||    
3'   cggauggg    ucg  cgg   uccg cggg    ucg  cgg   uccg cgg   g
   uu        ---a   gu   gga    u    ---a   gu   gga    u   ucg 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 2398652-2398761 [+]
antisense
Y38F2AR.10 ; Y38F2AR.10; intron 3
Database links

Mature sequence cel-miR-4930

Accession MIMAT0020136
Sequence

23 - 

ggcugccuagggggcuggcuag

 - 44

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).