Stem-loop sequence cel-mir-4932

AccessionMI0017718 (change log)
DescriptionCaenorhabditis elegans miR-4932 stem-loop
Stem-loop
   ------gugca          u     ----g    au a                  a 
5'            aaaagggauc gggaa     gggg  c acgaaaaggggaucuggc c
              |||||||||| |||||     ||||  | |||||||||||||||||| a
3'            uuuuuucuag uuuuu     cucc  g ugcuuuuccucuagaccg g
   caguuguuaaa          -     aaaua    gg g                  u 
Get sequence
Deep sequencing
315 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 9512307-9512416 [+]
intergenic
Database links

Mature sequence cel-miR-4932

Accession MIMAT0020138
Sequence

23 - 

ggggaucaacgaaaaggggauc

 - 44

Get sequence
Deep sequencing232 reads, 15 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).