Stem-loop sequence cel-mir-4933

AccessionMI0017719 (change log)
DescriptionCaenorhabditis elegans miR-4933 stem-loop
Stem-loop
   ------------------cucgugagcuu        c               uu     cag 
5'                              gccagaau gguggcagugaccua  cuggc   a
                                |||||||| |||||||||||||||  |||||    
3'                              cggucuua ccaccgucgcugggu  gaccg   u
   caccgucgcaggguuggaccgaucuagac        a               ug     auc 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 13182606-13182715 [-]
intergenic
Database links

Mature sequence cel-miR-4933

Accession MIMAT0020139
Sequence

23 - 

uggcagugaccuauucuggcca

 - 44

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; 454 [1]

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).