Stem-loop sequence cel-mir-4934

AccessionMI0017720 (change log)
DescriptionCaenorhabditis elegans miR-4934 stem-loop
Stem-loop
   auuuaauucuaaaa     -uuc    u  u   c   uc  uuuc   uuccg     aaa 
5'               aucau    ugac gu ggc ucu  au    gaa     cggca   a
                 |||||    |||| || ||| |||  ||    |||     |||||   a
3'               uagug    acug cg cug aga  ug    cuu     gccgu   g
   ----------ucga     uuuu    -  u   u   uc  ---u   --cga     gac 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 9825312-9825421 [-]
intergenic
Database links

Mature sequence cel-miR-4934

Accession MIMAT0020140
Sequence

68 - 

ugccgagcuucugucuagaug

 - 88

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).