Stem-loop sequence cel-mir-4935

AccessionMI0017721 (change log)
DescriptionCaenorhabditis elegans miR-4935 stem-loop
Stem-loop
   aguuac    ggu    ca   g -           g     a    aga  a   -  u 
5'       ggcg   uuug  agc c cggcgagagag uggag gcgc   ga agc ag c
         ||||   ||||  ||| | ||||||||||| ||||| ||||   || ||| || g
3'       ucgc   aaac  ucg g gccgcucucuc accuc cgcg   cu ucg uc c
   ------    -au    ag   - c           -     c    --g  g   a  g 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 18562477-18562586 [+]
antisense
Y51A2D.12 ; Y51A2D.12; intron 5
Database links

Mature sequence cel-miR-4935

Accession MIMAT0020141
Sequence

23 - 

gccggcgagagagguggagagcg

 - 45

Get sequence
Deep sequencing10 reads, 5 experiments
Evidence experimental; 454 [1]

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).