Stem-loop sequence cel-mir-4936

AccessionMI0017722 (change log)
DescriptionCaenorhabditis elegans miR-4936 stem-loop
Stem-loop
   -------uauacgcuauc   a  aua    uuuau        u   -----u   ccucu 
5'                   gag ua   agca     ggcuacaa gua      acg     c
                     ||| ||   ||||     |||||||| |||      |||     a
3'                   cuc au   ucgu     ucgguguu cgu      ugc     a
   caacgcacuuuccguuuu   a  -gg    ----u        u   uacacu   auuaa 
Get sequence
Deep sequencing
1459 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 3249151-3249260 [+]
intergenic
Database links

Mature sequence cel-miR-4936

Accession MIMAT0020142
Sequence

68 - 

ugcuuuguggcuuugcuggua

 - 88

Get sequence
Deep sequencing1459 reads, 16 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).