Stem-loop sequence cel-mir-4937

AccessionMI0017723 (change log)
DescriptionCaenorhabditis elegans miR-4937 stem-loop
Stem-loop
   ----------------gauuuugggcgcaguggcgcaa     uaga    -    gg     c 
5'                                       cuggg    gguu gggc  uggau g
                                         |||||    |||| ||||  ||||| c
3'                                       ggccc    ccaa cuug  gccug a
   uauuucaguuauaguaguuuuguuuuuauaaauggugg     ----    g    ga     g 
Get sequence
Deep sequencing
5464 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 1381705-1381814 [-]
intergenic
Database links

Mature sequence cel-miR-4937

Accession MIMAT0020143
Sequence

23 - 

cuggguagagguugggcggugga

 - 45

Get sequence
Deep sequencing5453 reads, 11 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).