Stem-loop sequence dme-mir-4941

AccessionMI0017727 (change log)
DescriptionDrosophila melanogaster miR-4941 stem-loop
Literature search

1 open access papers mention dme-mir-4941
(1 sentences)

Stem-loop
   augacc    a - agaug        c    u  --          --  gc 
5'       ggcg g g     cgauuccu gagc gc  ucaccgccuu  ug  u
         |||| | |     |||||||| |||| ||  ||||||||||  ||  u
3'       ucgc c c     gcugaggg cucg cg  gguggcggag  ac  g
   -acaac    a a guaua        u    c  cc          cu  ag 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 16031189-16031291 [+]
sense
FBtr0075435 ; Notum-RA; 3'UTR (exon 4)
Database links

Mature sequence dme-miR-4941-5p

Accession MIMAT0020148
Sequence

24 - 

ccucgagcugcucaccgccuu

 - 44

Get sequence
Deep sequencing13 reads, 6 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-4941-3p

Accession MIMAT0020149
Sequence

60 - 

ggcgguggccgccgcucugggagu

 - 83

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).