Stem-loop sequence dme-mir-4944

AccessionMI0017730 (change log)
DescriptionDrosophila melanogaster miR-4944 stem-loop
Literature search

1 open access papers mention dme-mir-4944
(1 sentences)

Stem-loop
   aaaaguaacuuucguaaucgaaaaaguuuc              uu   cc       aaguuuu 
5'                               gcuuuuuuuucugc  cug  gcugagc       a
                                 ||||||||||||||  |||  |||||||       a
3'                               ugaaaagaaggacg  gac  ugauucg       a
   ----uaaauacaugcaucagguauuaauau              uc   au       ccauuau 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 10513005-10513133 [-]
sense
FBtr0301345 ; hth-RG; intron 6
FBtr0082253 ; hth-RD; intron 10
FBtr0082254 ; hth-RB; intron 11
FBtr0301956 ; hth-RH; intron 11
FBtr0082255 ; hth-RC; intron 12
FBtr0082256 ; hth-RA; intron 12
Database links

Mature sequence dme-miR-4944-5p

Accession MIMAT0020153
Sequence

38 - 

uuucugcuucugccgcugagca

 - 59

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4944-3p

Accession MIMAT0020154
Sequence

78 - 

uuaguuacagcugcaggaagaa

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).