Stem-loop sequence dme-mir-4963

AccessionMI0017749 (change log)
DescriptionDrosophila melanogaster miR-4963 stem-loop
Literature search

1 open access papers mention dme-mir-4963
(1 sentences)

Stem-loop
   cugu     auuu    g  u             uaa             cag gu 
5'     aggaa    uuug gg acuucugguuuca   cgcagagaaucau   c  g
       |||||    |||| || |||||||||||||   |||||||||||||   |   
3'     uucuu    aaac uc ugaagaccaaggu   gcgucucuuagua   g  a
   -auu     --gu    g  c             cgg             --a ga 
Get sequence
Deep sequencing
56 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 5790753-5790861 [+]
sense
FBtr0070813 ; CG15767-RA; exon 1
Database links

Mature sequence dme-miR-4963-5p

Accession MIMAT0020185
Sequence

28 - 

gguuucauaacgcagagaauc

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4963-3p

Accession MIMAT0020186
Sequence

66 - 

auucucugcgggcuggaaccag

 - 87

Get sequence
Deep sequencing55 reads, 28 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).