Stem-loop sequence dme-mir-4966

AccessionMI0017752 (change log)
DescriptionDrosophila melanogaster miR-4966 stem-loop
Literature search

1 open access papers mention dme-mir-4966
(1 sentences)

Stem-loop
   -----------------gcugugugacaacaaacuug    c   g    a        a   c      u 
5'                                      ucgg acu gagu cuaaauau uug acaugu c
                                        |||| ||| |||| |||||||| ||| ||||||  
3'                                      agcc uga cuca gauuuaua aac uguacg a
   acuacaagcacaauaaaaagcaaagcaacaaguaaaa    a   a    c        c   u      u 
Get sequence
Deep sequencing
493 reads, 48.4 reads per million, 31 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19558370-19558496 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-4966
dme-mir-972chrX: 19551152-19551242 [+]
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
dme-mir-979chrX: 19561837-19561931 [+]
Database links

Mature sequence dme-miR-4966-5p

Accession MIMAT0020190
Sequence

33 - 

uacuaaauauauugcacauguu

 - 54

Get sequence
Deep sequencing95 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-4966-3p

Accession MIMAT0020191
Sequence

61 - 

uguucaacauauuuagcacuca

 - 82

Get sequence
Deep sequencing348 reads, 18 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).