Stem-loop sequence dme-mir-4967

AccessionMI0017753 (change log)
DescriptionDrosophila melanogaster miR-4967 stem-loop
Literature search

1 open access papers mention dme-mir-4967
(1 sentences)

Stem-loop
   cuaua   --    -cu  ug    aa     uu u    c     a  u uaca 
5'      gcg  uugu   cu  cgca  uugca  u cucu uguua ca g    c
        |||  ||||   ||  ||||  |||||  | |||| ||||| || |    a
3'      cgc  aacg   ga  gugu  aacgu  a ggga acaau gu c    u
   gccua   ca    acu  gu    --     uu c    a     -  c uuaa 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 10012093-10012199 [-]
sense
FBtr0088438 ; Pka-R2-RB; intron 2
FBtr0088437 ; Pka-R2-RA; intron 2
FBtr0112901 ; Pka-R2-RD; intron 2
FBtr0112902 ; Pka-R2-RE; intron 2
Database links

Mature sequence dme-miR-4967-5p

Accession MIMAT0020192
Sequence

26 - 

ugcauuuucucucuguuaac

 - 45

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4967-3p

Accession MIMAT0020193
Sequence

64 - 

uaacaaagggcauuugcaaugu

 - 85

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).