Stem-loop sequence dme-mir-4970

AccessionMI0017756 (change log)
DescriptionDrosophila melanogaster miR-4970 stem-loop
Stem-loop
   ccaaa  u   c  ca    cu        c   u   g    uauucu  ag 
5'      gg ggg ga  aggg  gggagcag agu gcu gcgg      ga  c
        || ||| ||  ||||  |||||||| ||| ||| ||||      ||   
3'      cc ccu cu  uccc  uccucguu ucg ugg ugcc      cu  u
   -uucg  u   u  cc    ag        c   u   g    ----uu  cg 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 10741885-10741987 [+]
antisense
FBtr0080119 ; CG6729-RA; exon 4
Clustered miRNAs
< 10kb from dme-mir-4970
dme-mir-4970chr2L: 10741885-10741987 [+]
dme-mir-9378chr2L: 10751877-10751938 [-]
Database links

Mature sequence dme-miR-4970-5p

Accession MIMAT0020197
Sequence

21 - 

cugggagcagcaguugcuggcg

 - 42

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).