Stem-loop sequence dme-mir-4972

AccessionMI0017758 (change log)
DescriptionDrosophila melanogaster miR-4972 stem-loop
Literature search

1 open access papers mention dme-mir-4972
(1 sentences)

Stem-loop
   aauca    cg -  ua    ucc       -   -----------               au 
5'      aaag  c cg  ggcc   accucgg cuu           uacagauauauauau  a
        ||||  | ||  ||||   ||||||| |||           |||||||||||||||  u
3'      uuuc  g gc  cugg   uggaguc gag           gugucuauauaugug  a
   -----    au a  --    --u       a   uuagggcuagc               cu 
Get sequence
Deep sequencing
109 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 3636967-3637073 [-]
sense
FBtr0089305 ; for-RB; intron 1
FBtr0089310 ; for-RH; intron 2
FBtr0089304 ; for-RA; intron 3
FBtr0089312 ; for-RI; intron 3
Database links

Mature sequence dme-miR-4972-5p

Accession MIMAT0020199
Sequence

25 - 

ccucggcuuuacagauauauau

 - 46

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4972-3p

Accession MIMAT0020200
Sequence

61 - 

uauaucugugcgaucgggauug

 - 82

Get sequence
Deep sequencing35 reads, 19 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).