Stem-loop sequence dme-mir-4979

AccessionMI0017765 (change log)
DescriptionDrosophila melanogaster miR-4979 stem-loop
Literature search

1 open access papers mention dme-mir-4979
(1 sentences)

Stem-loop
   ----  u      uauaucuag   a           uu  uc        ag  au 
5'     ca aggugu         gcc aauauauauac  gu  uauguauu  uu  u
       || ||||||         ||| |||||||||||  ||  ||||||||  ||  u
3'     gu ucuaca         ugg uuauauauaug  cg  guacauaa  aa  g
   uuaa  u      ---cuaaaa   c           uc  -u        gg  ac 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 23734033-23734141 [-]
intergenic
Database links

Mature sequence dme-miR-4979-5p

Accession MIMAT0020211
Sequence

26 - 

auauauacuuguucuauguauu

 - 47

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4979-3p

Accession MIMAT0020212
Sequence

64 - 

auacaugugccuguauauauau

 - 85

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).