Stem-loop sequence dme-mir-4985

AccessionMI0017771 (change log)
DescriptionDrosophila melanogaster miR-4985 stem-loop
Literature search

1 open access papers mention dme-mir-4985
(1 sentences)

Stem-loop
   uugggggcgcugcacuggcauugaa      a      u a   -      ggga 
5'                          aaguga uuacau g ucg ugacau    a
                            |||||| |||||| | ||| ||||||    u
3'                          uuugcu aaugua c agc gcugua    g
   -----------aucugcccauccgg      a      c g   c      aaag 
Get sequence
Deep sequencing
464 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 24294231-24294331 [+]
sense
FBtr0072268 ; CG3394-RA; intron 1
Database links

Mature sequence dme-miR-4985-5p

Accession MIMAT0020221
Sequence

29 - 

ugaauuacauugaucgugacau

 - 50

Get sequence
Deep sequencing457 reads, 31 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-4985-3p

Accession MIMAT0020222
Sequence

65 - 

ucgccgagccauguaaaucguu

 - 86

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).