Stem-loop sequence dme-mir-4986

AccessionMI0017772 (change log)
DescriptionDrosophila melanogaster miR-4986 stem-loop
Literature search

1 open access papers mention dme-mir-4986
(2 sentences)

Stem-loop
   uucugccgcuuuugcu        u     -     -    -    u   c    c  c auc 
5'                 guggcuuc cugca uggga uucc ccau cug augg gc g   u
                   |||||||| ||||| ||||| |||| |||| ||| |||| || |    
3'                 cgcuggag gacgu accuu aagg ggua ggc uacc cg c   c
   gucuaggacgucucuu        c     g     c    c    -   -    -  a cgu 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 9733659-9733780 [-]
sense
FBtr0076410 ; CG6749-RA; exon 1
Database links

Mature sequence dme-miR-4986-5p

Accession MIMAT0020223
Sequence

31 - 

ugggauuccccauucugcauggc

 - 53

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4986-3p

Accession MIMAT0020224
Sequence

70 - 

ccaucggauggcggaacuucc

 - 90

Get sequence
Deep sequencing10 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).