Stem-loop sequence egr-mir-153

AccessionMI0017788 (change log)
DescriptionEchinococcus granulosus miR-153 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
        uaaau     c     -     c    guu  aa    u 
5' agucg     gcuua gagac gugca ucca   gg  uggu g
   |||||     ||||| ||||| ||||| ||||   ||  |||| u
3' ucagc     ugaau cucug uacgu aggu   cc  auca c
        uaccg     a     a     u    guu  --    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000047.1: 276191-276278 [-]
intergenic
Database links

Mature sequence egr-miR-153-5p

Accession MIMAT0037428
Sequence

9 - 

augcuuacgagacgugcacuc

 - 29

Get sequence
Evidence experimental; Illumina [2]

Mature sequence egr-miR-153-3p

Accession MIMAT0020244
Sequence

61 - 

uugcauagucucauaagugcca

 - 82

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:21219906 "Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes" Cucher M, Prada L, Mourglia-Ettlin G, Dematteis S, Camicia F, Asurmendi S, Rosenzvit M Int J Parasitol. 41:439-448(2011).
2
PMID:25656283 "microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach" Macchiaroli N, Cucher M, Zarowiecki M, Maldonado L, Kamenetzky L, Rosenzvit MC Parasit Vectors. 8:83(2015).