Stem-loop sequence egr-mir-277a

AccessionMI0017791 (change log)
DescriptionEchinococcus granulosus miR-277a stem-loop
Gene family MIPF0001221; mir-277_2
Literature search

2 open access papers mention egr-mir-277a
(14 sentences)

Stem-loop
   ------    -         cu       -    -c  cc  u 
5'       gggu agaaagugc  uuuacaa caug  ug  uc a
         |||| |||||||||  ||||||| ||||  ||  || u
3'       cccg ucuuuuacg  aaauguu guau  ac  ag g
   ccaaug    g         -u       u    uc  cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000001.1: 2377325-2377403 [+]
intergenic
Clustered miRNAs
< 10kb from egr-mir-277a
egr-mir-4989APAU02000001.1: 2377189-2377268 [+]
egr-mir-277aAPAU02000001.1: 2377325-2377403 [+]
Database links

Mature sequence egr-miR-277a-3p

Accession MIMAT0020247
Sequence

55 - 

uaaaugcauuuucuggcccgua

 - 76

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:21219906 "Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes" Cucher M, Prada L, Mourglia-Ettlin G, Dematteis S, Camicia F, Asurmendi S, Rosenzvit M Int J Parasitol. 41:439-448(2011).
2
PMID:25656283 "microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach" Macchiaroli N, Cucher M, Zarowiecki M, Maldonado L, Kamenetzky L, Rosenzvit MC Parasit Vectors. 8:83(2015).