Stem-loop sequence emu-let-7

AccessionMI0017797 (change log)
DescriptionEchinococcus multilocularis let-7 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   -u    a       -        uuu  a     u   g 
5'   gcug caaugug agguagug   cg auguc cug c
     |||| ||||||| ||||||||   || ||||| |||  
3'   cggc guuauac ucuaucac   gc uacag gau a
   cg    -       g        uuu  c     c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI3) Overlapping transcripts
scaffold_007003: 2372356-2372432 [-]
intergenic
Database links

Mature sequence emu-let-7-5p

Accession MIMAT0020253
Sequence

12 - 

ugagguaguguuucgaaugucu

 - 33

Get sequence
Evidence experimental; Illumina [2]

Mature sequence emu-let-7-3p

Accession MIMAT0037434
Sequence

46 - 

acauccguuucacuaucugcaua

 - 68

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21219906 "Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes" Cucher M, Prada L, Mourglia-Ettlin G, Dematteis S, Camicia F, Asurmendi S, Rosenzvit M Int J Parasitol. 41:439-448(2011).
2
PMID:25659494 "High-throughput characterization of Echinococcus spp. metacestode miRNomes" Cucher M, Macchiaroli N, Kamenetzky L, Maldonado L, Brehm K, Rosenzvit MC Int J Parasitol. 45:253-267(2015).