Stem-loop sequence gma-MIR156i

AccessionMI0017820 (change log)
DescriptionGlycine max miR156i stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156i
(162 sentences)

Stem-loop 
   --uu    u  u         -              u  -   u       uuauauaaaaag  gcu  g 
5'     aagg ug ugacagaag auagagagcacaga ga uga augcaua            ca   ag g
       |||| || ||||||||| |||||||||||||| || ||| |||||||            ||   ||  
3'     uucc ac acugucuuc uaucucucguguuu cu acu uacgugu            gu   uc a
   cgac    c  u         a              c  c   c       ---------uaa  -ac  a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 41728607-41728736 [+]
intergenic
Database links

Mature sequence gma-miR156i

Accession MIMAT0020969
Sequence

10 -  

uugacagaagauagagagcac

 - 30

Get sequence
Evidence experimental; 454 [1], SOLiD [2], Illumina [3]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome" Radwan O, Liu Y, Clough SJ Mol Plant Microbe Interact. 24:958-972(2011).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).