Stem-loop sequence gma-MIR160b

AccessionMI0017821 (change log)
DescriptionGlycine max miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

20 open access papers mention gma-MIR160b
(59 sentences)

Stem-loop 
   augugua     c       cu          ug  u  u      a 
5'        ugugc uggcucc  guaugccauu  ca ag ucauug g
          ||||| |||||||  ||||||||||  || || |||||| c
3'        auacg accgagg  uaugcgguaa  gu uc aguaac a
   -------     a       ag          gu  u  u      u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 41668766-41668855 [+]
intergenic
Database links

Mature sequence gma-miR160b

Accession MIMAT0020970
Sequence

10 -  

ugccuggcucccuguaugcc

 - 29

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).