![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR160b |
|||||
Accession | MI0017821 (change log) | ||||
Description | Glycine max miR160b stem-loop | ||||
Gene family | MIPF0000032; MIR160 | ||||
Literature search |
![]()
20 open access papers mention gma-MIR160b | ||||
Stem-loop |
augugua c cu ug u u a 5' ugugc uggcucc guaugccauu ca ag ucauug g ||||| ||||||| |||||||||| || || |||||| c 3' auacg accgagg uaugcgguaa gu uc aguaac a ------- a ag gu u u u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR160b |
|
Accession | MIMAT0020970 |
Sequence |
10 - ugccuggcucccuguaugcc - 29 |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|