Stem-loop sequence gma-MIR164d

AccessionMI0017828 (change log)
DescriptionGlycine max miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164d
(37 sentences)

Stem-loop 
   guuaac  c           ca            -c   cuucu 
5'       uc uguuggagaag  gggcacgugcaa  uca     a
         || |||||||||||  ||||||||||||  |||     g
3'       ag acaaccucuuc  cucgugcacguu  agu     u
   ccuuuu  c           cc            uu   cuaau
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 38618021-38618110 [+]
intergenic
Database links

Mature sequence gma-miR164d

Accession MIMAT0020977
Sequence

13 -  

uggagaagcagggcacgugc

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).