![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR164d |
|||||
Accession | MI0017828 (change log) | ||||
Description | Glycine max miR164d stem-loop | ||||
Gene family | MIPF0000045; MIR164 | ||||
Literature search |
![]()
17 open access papers mention gma-MIR164d | ||||
Stem-loop |
guuaac c ca -c cuucu 5' uc uguuggagaag gggcacgugcaa uca a || ||||||||||| |||||||||||| ||| g 3' ag acaaccucuuc cucgugcacguu agu u ccuuuu c cc uu cuaau |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR164d |
|
Accession | MIMAT0020977 |
Sequence |
13 - uggagaagcagggcacgugc - 32 |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|