Stem-loop gma-MIR166d

Accession

MI0017830

Description

Glycine max gma-MIR166d precursor miRNA

Gene family

MIPF0000004; MIR166

Literature search

36 open access papers mention gma-MIR166d
(214 sentences)

Sequence

aggaguugaggggaauggugucugguucgagaccauucuucugaagcaaagaucaucaucaucacccuugagaaugaucUCGGACCAGGCUUCAUUCCCCcuagcucaaa
..((((((.(((((((((.(((((((((((((.(((((((...(((....(((.......)))...)))))))))).))))))))))))).))))))))).))))))...

Structure

-ag      a         u             c       cug   caaa   ca 
   gaguug ggggaaugg gucugguucgaga cauucuu   aag    gau  u
   |||||| ||||||||| ||||||||||||| |||||||   |||    |||  c
   cucgau CCCCUUACU CGGACCAGGCUcu guaagag   uuc    cua  a
aaa      c         U             a       ---   -cca   cu 

Annotation confidence Not enough data

Genome context

chr20: 44227240-44227349 [-]

Mature gma-miR166d

• Accession: MIMAT0020979
• Description: Glycine max gma-miR166d mature miRNA
• Sequence: 80 - UCGGACCAGGCUUCAUUCCCC - 100
• Evidence: experimental ; 454 [1], Illumina [2]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


2. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506