Stem-loop sequence gma-MIR319d

AccessionMI0017842 (change log)
DescriptionGlycine max miR319d stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319d
(42 sentences)

Stem-loop
   ----    u            -     c   --       uu   ggauuaa     u  u     a   g   ac           cauagaa   ug  u 
5'     agag gaaggagcuucc uuuag cca  cacaugg  agg       agggu gc gaagu ucu cug  ucauucauaca       uag  au c
       |||| |||||||||||| ||||| |||  |||||||  |||       ||||| || ||||| ||| |||  |||||||||||       |||  ||  
3'     ucuu cuuccucgaggg aaguc ggu  guguauc  ucu       uccua cg uuuua agg gac  aguaagugugu       auc  ua a
   guug    u            g     a   uc       uu   -------     -  -     c   g   ga           uaaugga   gu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 40974346-40974535 [-]
intergenic
Database links

Mature sequence gma-miR319d

Accession MIMAT0020992
Sequence

160 - 

uggacugaaggggagcuccuuc

 - 181

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).