Stem-loop sequence gma-MIR319e

AccessionMI0017843 (change log)
DescriptionGlycine max miR319e stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319e
(42 sentences)

Stem-loop
          a  a                 cu          u      uu   a   g  g   ac        u  aa        ---   -  g 
5' auaguug ag gagcuuccuucagucca  cauggauggg aagggg  aga uua cu cug  ucauucau ca  cacaauag   auc ug c
   ||||||| || |||||||||||||||||  |||||||||| ||||||  ||| ||| || |||  |||||||| ||  ||||||||   ||| ||  
3' ugucaau uc cucgagggaagucaggu  gugucugucc uuuccu  uuu aau ga ggc  aguaagug gu  guguuauc   uag ac a
          c  c                 uc          u      uc   a   g  g   gu        u  aa        gua   u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 47276795-47276984 [+]
intergenic
Database links

Mature sequence gma-miR319e

Accession MIMAT0020993
Sequence

162 - 

uuggacugaagggagcuccc

 - 181

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).