Stem-loop sequence gma-MIR390c

AccessionMI0017845 (change log)
DescriptionGlycine max miR390c stem-loop
Gene family MIPF0000101; MIR390
Literature search

20 open access papers mention gma-MIR390c
(72 sentences)

Stem-loop
   ------u  a          g         cau   u    ucuucu 
5'        gu aagcucagga ggauagcgc   gga gauc      c
          || |||||||||| |||||||||   ||| ||||       
3'        ua uuugaguccu ccuaucgcg   ucu cuag      c
   ucuucgg  c          a         uuc   u    uucuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 43181160-43181249 [+]
intergenic
Database links

Mature sequence gma-miR390c

Accession MIMAT0020995
Sequence

62 - 

cgcuauccauccugaguuuc

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).