Stem-loop sequence gma-MIR482c

Accession

MI0017851 (change log)

Description

Glycine max miR482c stem-loop

Gene family

MIPF0000403; MIR482

Literature search

21 open access papers mention gma-MIR482c
(46 sentences)

Stem-loop

   -    u ug           -u         guaau         ca 
5'  agaa u  ugggaaugggc  gauugggaa     gagauugag  a
    |||| |  |||||||||||  |||||||||     |||||||||  u
3'  ucuu a  auccuuacccg  uuaacccuu     cuuuaauuu  a
   g    u gu           cc         -----         ac 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr18: 57154765-57154854 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0017851

Mature sequence gma-miR482c-5p

• Accession: MIMAT0021001
• Sequence: 4 - auuugugggaaugggcugauugg - 26
• Evidence: experimental; Illumina [2-3]

Mature sequence gma-miR482c-3p

• Accession: MIMAT0021002
• Sequence: 60 - uucccaauuccgcccauuccu - 80
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2. PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
3. PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).