![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR482c |
|||||
Accession | MI0017851 (change log) | ||||
Description | Glycine max miR482c stem-loop | ||||
Gene family | MIPF0000403; MIR482 | ||||
Literature search |
![]()
21 open access papers mention gma-MIR482c | ||||
Stem-loop |
- u ug -u guaau ca 5' agaa u ugggaaugggc gauugggaa gagauugag a |||| | ||||||||||| ||||||||| ||||||||| u 3' ucuu a auccuuacccg uuaacccuu cuuuaauuu a g u gu cc ----- ac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR482c-5p |
|
Accession | MIMAT0021001 |
Sequence |
4 - auuugugggaaugggcugauugg - 26 |
Evidence | experimental; Illumina [2-3] |
Mature sequence gma-miR482c-3p |
|
Accession | MIMAT0021002 |
Sequence |
60 - uucccaauuccgcccauuccu - 80 |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
2 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
3 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|