miRBase entry: gma-MIR1507c

Stem-loop gma-MIR1507c


Accession
MI0017854
Description
Glycine max gma-MIR1507c precursor miRNA

Literature search
17 open access papers mention gma-MIR1507c
(39 sentences)

Sequence

ugcuaGAGGUGUUUGGGAUGAGAGAAuagaauuuuuucaaaugcuugaaagugaucucuucCCUCAUUCCAAACAUCAUCUaacacacau
((.(((((((((((((((((((.(((.(((...(((((((....)))))))...))).))).))))))))))))))).)))).)).....

Structure
-----  c    -               A   u   auu       a 
     ug uaGA GGUGUUUGGGAUGAG GAA aga   uuuucaa u
     || |||| ||||||||||||||| ||| |||   |||||||  
     ac aUCU CUACAAACCUUACUC cuu ucu   gaaaguu g
uacac  a    A               C   c   agu       c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr9: 17134380-17134469 [-]

Database links

Mature gma-miR1507c-5p

Accession MIMAT0021005
Description Glycine max gma-miR1507c-5p mature miRNA
Sequence 6 - GAGGUGUUUGGGAUGAGAGAA - 26
Evidence experimental
SOLiD [2], Illumina [3-4]

Mature gma-miR1507c-3p

Accession MIMAT0021006
Description Glycine max gma-miR1507c-3p mature miRNA
Sequence 62 - CCUCAUUCCAAACAUCAUCU - 81
Evidence experimental
454 [1], Illumina [3,5]

References

  1. PubMed ID: 21663675
    Identification of novel soybean microRNAs involved in abiotic and biotic stresses
    Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
    BMC Genomics (2011) 12:307

  2. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  3. PubMed ID: 21751852
    Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome
    "Radwan O, Liu Y, Clough SJ"
    "Mol Plant Microbe Interact (2011) 24:958-972

  4. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  5. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153