Stem-loop sequence gma-MIR1513b

AccessionMI0017856 (change log)
DescriptionGlycine max miR1513b stem-loop
Literature search

1 open access papers mention gma-MIR1513b
(3 sentences)

Stem-loop
   ugc  u     a     a        ug   -   a 
5'    gu uguaa ucaug cuuucucu  uau cuc u
      || ||||| ||||| ||||||||  ||| |||  
3'    ca acauu aguac gaaagaga  aua gag c
   ---  c     c     c        gu   u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 223665-223734 [-]
intergenic
Database links

Mature sequence gma-miR1513b

Accession MIMAT0021008
Sequence

46 - 

ugagagaaagccaugacuuac

 - 66

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).