Stem-loop sequence gma-MIR1535b

AccessionMI0017857 (change log)
DescriptionGlycine max miR1535b stem-loop
Literature search

3 open access papers mention gma-MIR1535b
(9 sentences)

Stem-loop
   ucuuug    c     u    -   -ug      cc    ag    ga 
5'       guga uuguu gugg uga   ucuagg  ucuu  ccuu  g
         |||| ||||| |||| |||   ||||||  ||||  ||||   
3'       uauu aacga cacc auu   ggguuc  agga  ggaa  a
   ----ug    a     -    u   caa      -a    aa    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 43989927-43990016 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR1535b
gma-MIR160cchr19: 43999110-43999200 [-]
gma-MIR1535achr19: 43989978-43990073 [+]
gma-MIR1535bchr19: 43989927-43990016 [-]
Database links

Mature sequence gma-miR1535b

Accession MIMAT0021009
Sequence

11 - 

cuuguuuguggugaugucuag

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).