Stem-loop sequence gma-MIR4992

AccessionMI0017858 (change log)
DescriptionGlycine max miR4992 stem-loop
Literature search

1 open access papers mention gma-MIR4992
(1 sentences)

Stem-loop
   -       c  gacc   u      g            a               u 
5'  agaugau uc    caa aaccgu uuagaauguacg uauuuuaagaugguc c
    ||||||| ||    ||| |||||| |||||||||||| ||||||||||||||| a
3'  ucugcua ag    guu uuggua aaucuuacaugu auaaaauucugccag g
   u       -  -auu   u      g            a               c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 9413832-9413941 [-]
intergenic
Database links

Mature sequence gma-miR4992

Accession MIMAT0021010
Sequence

80 - 

auucuaagaugguuuuuguuag

 - 101

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).