Stem-loop sequence gma-MIR4998

AccessionMI0017864 (change log)
DescriptionGlycine max miR4998 stem-loop
Gene family MIPF0001304; MIR4998
Literature search

1 open access papers mention gma-MIR4998
(2 sentences)

Stem-loop
   aauuugggag      u  g   u        a              a        a      uua   a 
5'           aagggc gc guc aggucgag guuucgugacuaca cuucugaa cgcguc   uuu u
             |||||| || ||| |||||||| |||||||||||||| |||||||| ||||||   |||  
3'           uuccug cg cag uccagcuc caaagcacugaugu gaagacuu gugcag   aag g
   ----------      -  g   u        c              c        c      uag   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR4998

Accession MIMAT0021016
Sequence

33 - 

aguuucgugacuacaacuucug

 - 54

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).