Stem-loop sequence ath-MIR5014a

AccessionMI0017882 (change log)
Previous IDsath-MIR5014
DescriptionArabidopsis thaliana miR5014a stem-loop
Gene family MIPF0001634; MIR5014
Stem-loop
           cua                  u                        a  aaa   a     a 
5' auuuuuua   uuugauucguacacuuag uuuguacaacauuuuuaguguaca au   uaa uguac c
   ||||||||   |||||||||||||||||| |||||||||||||||||||||||| ||   ||| ||||| a
3' ugaaaagu   aaacuaagcaugugaauu aaacauguugugaaaaucacaugu ua   auu acaug g
           auc                  u                        c  --c   c     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 24553909-24554049 [+]
intergenic
Database links

Mature sequence ath-miR5014a-5p

Accession MIMAT0021047
Previous IDsath-miR5014-5p
Sequence

22 - 

acacuuaguuuuguacaacau

 - 42

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ath-miR5014a-3p

Accession MIMAT0020518
Previous IDsath-miR5014;ath-miR5014-3p
Sequence

103 - 

uuguacaaauuuaaguguacg

 - 123

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).
2
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).