Stem-loop sequence ath-MIR5020a

AccessionMI0017888 (change log)
DescriptionArabidopsis thaliana miR5020a stem-loop
Gene family MIPF0001226; MIR5020
Stem-loop
        aa    -       ugaga    auua g      ggc      au           a        -   --      aauca 
5' aaaua  gcaa aucuaag     gaua    u agugau   cauggc  ggaagaaggug gacuugca uga  aucgug     a
   |||||  |||| |||||||     ||||    | ||||||   ||||||  ||||||||||| |||||||| |||  ||||||      
3' uuuau  uguu uagauuc     uuau    a ucacua   guaccg  ccuuuuuccau cugaacgu acu  uaguac     a
        ca    c       -uaaa    ---g g      aua      au           g        c   au      cucca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 6791301-6791470 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR5020a
ath-MIR5020achr4: 6791301-6791470 [-]
ath-MIR5020bchr4: 6787003-6787153 [-]
Database links

Mature sequence ath-miR5020a

Accession MIMAT0020524
Sequence

50 - 

uggaagaaggugagacuugca

 - 70

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).
2
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).