Stem-loop sequence ath-MIR5021

AccessionMI0017889 (change log)
DescriptionArabidopsis thaliana miR5021 stem-loop
Literature search

7 open access papers mention ath-MIR5021
(16 sentences)

Stem-loop
       u      gaauuu       g ga      gagg   -           g  g  -   agu   -u       u   --g     u 
5' guag gaugau      gagauuu g  gaggga    auu gagaagaagaa aa aa aag   gau  ugagagu cau   ggucu g
   |||| ||||||      ||||||| |  ||||||    ||| ||||||||||| || || |||   |||  ||||||| |||   |||||  
3' uauc cugcug      uuuugag u  cuucuu    uaa cucuucuucuu uu uu uuc   cua  gcuuuca gug   uuaga a
       u      ------       g aa      -gaa   u           g  g  g   cuu   uu       -   auu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 11974711-11974881 [-]
intergenic
Database links

Mature sequence ath-miR5021

Accession MIMAT0020525
Sequence

41 - 

ugagaagaagaagaagaaaa

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).