Stem-loop sequence ath-MIR5023

AccessionMI0017892 (change log)
DescriptionArabidopsis thaliana miR5023 stem-loop
Stem-loop
        -    -auccuu  c         a         u                  gauuuuu  a 
5' auguu gcau       ug caauuuugu aauugguag ggauaagggggcaaauuu       ca a
   ||||| ||||       || ||||||||| ||||||||| ||||||||||||||||||       ||  
3' ugcga ugua       ac guugaaaca uuagccguu ucuauuccuccguuuaag       gu u
        a    aaaauuc  c         c         u                  -acgauu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 5496985-5497119 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR5023
ath-MIR782chr3: 5500037-5500147 [+]
ath-MIR2934chr3: 5500032-5500152 [-]
ath-MIR5023chr3: 5496985-5497119 [-]
Database links

Mature sequence ath-miR5023

Accession MIMAT0020528
Sequence

30 - 

auugguaguggauaagggggc

 - 50

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).
2
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).